Prev. |  KEGG KO K06521 > 

RIKEN DNA Bank Human Resource - SEMA4D

Gene ID NCBI Gene 10507 |  KEGG hsa:10507
Gene Symbol SEMA4D
Protein Name semaphorin 4D
Synonyms A8|BB18|C9orf164|CD100|COLL4|GR3|M-sema-G|SEMAJ|coll-4
Featured content Axon guidance - human
Ortholog resource in our bank

  SEMA4D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX042922 IRAK107F02 pCMV-SPORT6 BC054500 NM_006378

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080828 M01C002B04 pDONR221 04-134-2_1-H02 BC054500 NM_182635  
HGE095206 M01C038A06 pDONR221 MGC08-F03 BC054500 NM_182635  
HGE095254 M01C038C06 pDONR221 MGC08-F03 BC054500 NM_182635  
HGE095302 M01C038E06 pDONR221 MGC08-F03 BC054500 NM_182635  
HGE095350 M01C038G06 pDONR221 MGC08-F03 BC054500 NM_182635  
HGE095398 M01C038I06 pDONR221 MGC08-F03 BC054500 NM_182635  
HGE095446 M01C038K06 pDONR221 MGC08-F03 BC054500 NM_182635  
HGE095494 M01C038M06 pDONR221 MGC08-F03 BC054500 NM_182635  
HGE095542 M01C038O06 pDONR221 MGC08-F03 BC054500 NM_182635  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008676 W01A021L12 pENTR-TOPO IRAK107F02 BC054500 NM_006378  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR372007 RBd30A07 pGCAP10 NM_006378.2  
GGCACTCCGTCCCCGCGCCGGCCTCAGCGCTCTCGCGCGCCGCAGCATCCCAGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl