Prev. |  KEGG KO K05931 > 

RIKEN DNA Bank Human Resource - CARM1

Gene ID NCBI Gene 10498 |  KEGG hsa:10498
Gene Symbol CARM1
Protein Name coactivator associated arginine methyltransferase 1
Synonyms PRMT4
Ortholog resources KEGG ortholog (KEGG orthology K05931) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031471 IRAK078L07 pCMV-SPORT6 BC036886 NM_199141 Partial/var
HGY097737 IRAL044F17 pOTB7 BC046240 NM_199141 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR332125 RBb30F05 pGCAP1 NM_199141.1  
HKR391377 RBd78H09 pGCAP10 NM_199141.1  
GGGCCTGCACGGCGGCTGCGGCGGCGGTAGCGGCAGCGGCGGCGGCGGCGGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl