DNA Bank Top |  KEGG KO K13160 > 

RIKEN DNA Bank Human Resource - SYNCRIP

Gene ID NCBI Gene 10492 |  KEGG hsa:10492
Gene Symbol SYNCRIP
Protein Name synaptotagmin binding cytoplasmic RNA interacting protein
Synonyms GRY-RBP|GRYRBP|HNRNPQ|HNRPQ1|NSAP1|PP68|hnRNP-Q

Link

Ortholog resource in our bank

  SYNCRIP


External database

human SYNCRIP

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB17345 pEF6-FLAG-human Syncrip (iso1) Expression vector of human SYNCRIP (Isoform 1) tagged with FLAG at N-terminus.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035247 IRAK088B23 pCMV-SPORT6 BC040844 NM_006372 Partial/var
HGX027743 IRAK069F23 pCMV-SPORT6 BC032643 NM_006372 Partial/var
HGY093219 IRAL033A19 pOTB7 BC015575 NM_006372 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR123725 ARh09F05 pGCAP1 NM_006372.3  
GGGCGTGAGCTTCGGCCGCCATTTTACAACAGCTCCACTCGCGCCGGACACAGG
HKR474914 RBdS187E18 pGCAP10 NM_006372.3  
GACTCGCGCCGGACACAGGGAGCAGCGAGCACGCGTTTCCCGCAACCCGATACCATCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.03

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl