Prev. |  KEGG KO K19606 > 

RIKEN DNA Bank Human Resource - CRTAP

Gene ID NCBI Gene 10491 |  KEGG hsa:10491
Gene Symbol CRTAP
Protein Name cartilage associated protein
Synonyms CASP|LEPREL3|OI7|P3H5
Ortholog resources KEGG ortholog (KEGG orthology K19606) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082216 IRAL005I24 pOTB7 BC008745 NM_006371 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR074851 ARe87C03 pKA1U5 NM_006371.4  
GCTTTTCGCCGGGCGCGATGGAGCCGGGGCGCCGGGGGGCCGCGGCGCTGCTAGCGCTGC
HKR209450 ARiS023K10 pGCAP10 NM_006371.4  
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTTTCCTTCTCCCTCCCCTTTTCCCTTCCT
HKR234258 ARiS085K18 pGCAP10 NM_006371.4  
GCCTTTCGCCGGGCGCGATGGAGCCGGGGCGCCGGGGGGCCGCGGCGCTGCTAGCGCTGC
HKR442211 RBdS105I19 pGCAP10 NM_006371.4  
GCCTTTCGCCGGGCGCGATGGAGCCGGGGCGCCGGGGGGCCGCGGCGCTGCTAGCGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl