Prev. |  KEGG KO K10347 > 

RIKEN DNA Bank Human Resource - LRRC41

Gene ID NCBI Gene 10489 |  KEGG hsa:10489
Gene Symbol LRRC41
Protein Name leucine rich repeat containing 41
Synonyms MUF1|PP7759
Ortholog resource in our bank

  LRRC41

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085583 IRAL013P23 pOTB7 BC004953 NM_006369 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074081 ARe85D09 pKA1U5 NM_006369.4  
GGAGGTAGCGGCGGCAACGACCATGGAGGCCACGTCCCGGGAGGCGGCGCCAGCGAAGAG
HKR181373 ARi53H05 pGCAP10 NM_006369.4  
GCTGTTCGAGCTGTGCGGGCGGGCGGTGAGCGCCCATATGGGGGTTCTGGAGAGCGGGGT
HKR386131 RBd65F11 pGCAP10 NM_006369.4  
GGAGGTAGCGGCGGCAACGACCATGGAGGCCACGTCCCGGGAGGCGGCGCCAGCGAAGAG
HKR432766 RBdS081P06 pGCAP10 NM_006369.4  
GGAGGTAGCGGCGGCAACGACCATGGAGGCCACGTCCCGGGAGGCGGCGCCAGCGAAGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl