Prev. |  KEGG KO K17261 > 

RIKEN DNA Bank Human Resource - CAP1

Gene ID NCBI Gene 10487 |  KEGG hsa:10487
Gene Symbol CAP1
Protein Name cyclase associated actin cytoskeleton regulatory protein 1
Synonyms CAP|CAP1-PEN
Ortholog resources KEGG ortholog (KEGG orthology K17261) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084041 IRAL010B17 pOTB7 BC013963 NM_006367 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049301 ARe23E05 pKA1U5 NM_006367.3  
GGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGCAGGTGGTCCATTATG
HKR060808 ARe52A08 pKA1U5 NM_006367.3  
GGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCNCATTTCCGGAGGTGGTCCATTATGGCT
HKR069250 ARe73C02 pKA1U5 NM_006367.3  
TGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGCGGTCCATTATGGCTGACATGCAAAAT
HKR078883 ARe97D11 pKA1U5 NM_006367.3  
GGGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGGTGGTCCAT
HKR181299 ARi53E03 pGCAP10 NM_006367.3  
GAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGGTGGTCCATTATGGCTGAC
HKR222034 ARiS055B10 pGCAP10 NM_006367.3  
TGGGCGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACT
HKR235454 ARiS088K14 pGCAP10 NM_006367.3  
GGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGGTGGTCCATTATGGCT
HKR260020 ARiS150A20 pGCAP10 NM_006367.3  
CGGCCGGCCGATGAGATTGCTGGGCGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCGCAG
HKR374881 RBd37D09 pGCAP10 NM_006367.3  
GGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGTGGTCCATTATGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl