Prev. |  KEGG KO K17261 > 

RIKEN DNA Bank Human Resource - CAP1

Gene ID NCBI Gene 10487 |  KEGG hsa:10487
Gene Symbol CAP1
Protein Name cyclase associated actin cytoskeleton regulatory protein 1
Synonyms CAP|CAP1-PEN
Ortholog resource in our bank

  CAP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084041 IRAL010B17 pOTB7 BC013963 NM_006367 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR049301 ARe23E05 pKA1U5 NM_006367.3  
GGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGCAGGTGGTCCATTATG
HKR060808 ARe52A08 pKA1U5 NM_006367.3  
GGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCNCATTTCCGGAGGTGGTCCATTATGGCT
HKR069250 ARe73C02 pKA1U5 NM_006367.3  
TGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGCGGTCCATTATGGCTGACATGCAAAAT
HKR078883 ARe97D11 pKA1U5 NM_006367.3  
GGGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGGTGGTCCAT
HKR181299 ARi53E03 pGCAP10 NM_006367.3  
GAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGGTGGTCCATTATGGCTGAC
HKR222034 ARiS055B10 pGCAP10 NM_006367.3  
TGGGCGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACT
HKR235454 ARiS088K14 pGCAP10 NM_006367.3  
GGAGAGCGGCTGATCGCAGTCCGGAGGTGAGGCGGAACTCTGAGGTGGTCCATTATGGCT
HKR260020 ARiS150A20 pGCAP10 NM_006367.3  
CGGCCGGCCGATGAGATTGCTGGGCGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCGCAG
HKR374881 RBd37D09 pGCAP10 NM_006367.3  
GGGTTCTTGCCGGAAGCGGAGAGCGGCTGATCGCAGTCCGGAGGTGGTCCATTATGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl