Prev. |  KEGG KO K17261 > 

RIKEN DNA Bank Human Resource - CAP2

Gene ID NCBI Gene 10486 |  KEGG hsa:10486
Gene Symbol CAP2
Protein Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K17261) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088778 IRAL021P18 pDNR-LIB BC008481 NM_006366 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059330 ARe48F10 pKA1U5 NM_006366.2  
AGGAGGGTACGAGTGGCCGACCACGGATTTGCATTGCCGAGGACGGGACCCCAGGGCAGC
HKR079771 ARe99H03 pKA1U5 NM_006366.2  
GGTCTGTATTTGGAGCTCCGGAAGCTGCCGGCGACTCTCCCCTGGAGCAGCGTGACTGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl