Prev. |  KEGG KO K14006 > 

RIKEN DNA Bank Human Resource - SEC23B

Gene ID NCBI Gene 10483 |  KEGG hsa:10483
Gene Symbol SEC23B
Protein Name SEC23 homolog B, COPII coat complex component
Synonyms CDA-II|CDAII|CDAN2|CWS7|HEMPAS|hSec23B
Ortholog resource in our bank

  SEC23B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001626 IRAK004B02 pCMV-SPORT6 BC005404 NM_032986 Full/var
HGY087345 IRAL018G01 pOTB7 BC005032 NM_032986 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE008652 W01A021K12 pENTR-TOPO IRAK004B02 BC005404 NM_032986 done
HGE008656 W01A021K16 pENTR-TOPO IRAK004B02 BC005404 NM_032986  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR169353 ARi23G09 pGCAP10 NM_006363.4  
GGGTGGGAGCCGGAGCCTGCTTGTTGCAGCTGTGGGTGAGGACGGCTCTAGCTAGTTCCC
HKR344482 RBb61D10 pGCAP1 NM_006363.4  
AAGGTTGCAGCTGTGGGTGAGGACGGCTCTAGCTAGGTGAGCGGCTCCGGCCAGTTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl