Prev. |  KEGG KO K13354 > 

RIKEN DNA Bank Human Resource - SLC25A17

Gene ID NCBI Gene 10478 |  KEGG hsa:10478
Gene Symbol SLC25A17
Protein Name solute carrier family 25 member 17
Synonyms PMP34
Ortholog resource in our bank

  SLC25A17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19191 PMP34-FTMT-GFP Expression vector of human PMP34 andFTMT tagged with GFP at C-terminus.

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY084586 IRAL011H18 pOTB7 BC012998 NM_006358 Full
HGY088407 IRAL021A07 pDNR-LIB BC005957 NM_006358 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE026097 W01A065E01 pENTR-TOPO IRAL021A07 BC005957 NM_006358  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046145 ARe15G01 pKA1U5 NM_006358.2  
GACTCTCACACCCTGAGCTCCGGTGCTCCTTTCCTAACTCCACTGGCTGCGGCATCTGTG
HKR178806 ARi47A06 pGCAP10 NM_006358.2  
AGCCTAACTCCACTGGCTGCGGCATCTGTGGGAAAAGTGTGGCTGGGTCTTCGAGGAGCC
HKR470859 RBdS177C11 pGCAP10 NM_006358.2  
CGGCCGGCCGATGACACACCCTGAGCTCCGGTGCTCCTTTCCTAACTCCACTGGCTGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl