Prev. |  KEGG KO K20217 > 

RIKEN DNA Bank Human Resource - UBE2E3

Gene ID NCBI Gene 10477 |  KEGG hsa:10477
Gene Symbol UBE2E3
Protein Name ubiquitin conjugating enzyme E2 E3
Synonyms UBCH9|UbcM2
Ortholog resource in our bank

  UBE2E3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083571 IRAL008P11 pOTB7 BC003554 NM_182678 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048930 ARe22F10 pKA1U5 NM_006357.2  
AACTGGAGCTCCCGCGTTTGACTATTTCAAAGGTTTTGCCTGTCTATTTGTTCCCTTTTG
HKR433436 RBdS083J20 pGCAP10 NM_006357.2  
GACCCTCCGGCCGGAGCCCGGCACTGCACAACCCCCTCCGACTTTCAATGTTCCACACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl