Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATP5H

Gene ID (NCBI) 10476
Gene Symbol ATP5H
Protein Name ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Synonyms ATPQ
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX024883 IRAK062D11 pCMV-SPORT6 BC032245 NM_001003785 Full
HGX033111 IRAK082M23 pCMV-SPORT6 BC038092 NM_006356 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR169652 ARi24C04 pGCAP10 NM_006356.2
GGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGCGAAA
HKR053230 ARe33B06 pKA1U5 NM_006356.2
GGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAGATGGCTGGGCGAAA
HKR054101 ARe35E05 pKA1U5 NM_006356.2
GGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAGATGGCTGGGCGAAA
HKR070153 ARe75G09 pKA1U5 NM_006356.2
GGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGCNGTTCGGTGAAGGATCCCAAGATGGC
HKR235377 ARiS088H09 pGCAP10 NM_006356.2
GGACCCACTTCCGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCC
HKR260243 ARiS150K03 pGCAP10 NM_006356.2
GACCCACTTCCGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCC
HKR327372 RBb18H04 pKA1U5 NM_006356.2
GTTCCGTTACTTGCTGCGGAGGACCGTGGGCAGCCNNTNGNTCGGTGAAGGATCCCAAAA
HKR367636 RBd19B12 pGCAP10 NM_006356.2
GGCCCGTGACCCACTTCCGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAA
HKR334178 RBb35H10 pGCAP1 NM_006356.2
GGTTCTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGG
HKR340171 RBb50H03 pGCAP1 NM_006356.2
AAATGTGTTTTTTTTTTTGGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAA
HKR340453 RBb51C05 pGCAP1 NM_006356.2
TTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGG
HKR341277 RBb53D05 pGCAP1 NM_006356.2
GACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGC
HKR380974 RBd52H06 pGCAP10 NM_006356.2
GACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGC
HKR381352 RBd53G08 pGCAP10 NM_006356.2
GCCGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAANGATCCCAAAATGGC
HKR346829 RBb67B05 pGCAP1 NM_006356.2
GACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGC
HKR420455 RBdS051C07 pGCAP10 NM_006356.2
GGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGCGAAAACT
HKR441623 RBdS104A23 pGCAP10 NM_006356.2
GGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl