Prev. |  KEGG KO K11302 > 

RIKEN DNA Bank Human Resource - HMGN4

Gene ID NCBI Gene 10473 |  KEGG hsa:10473
Gene Symbol HMGN4
Protein Name high mobility group nucleosomal binding domain 4
Synonyms HMG17L3|NHC
Ortholog resource in our bank

  HMGN4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001903 IRAK004M15 pCMV-SPORT6 BC001282 NM_006353 Full
HGY096618 IRAL041J02 pDNR-LIB BC035998 NM_006353

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000459 W01A001C11 pENTR-TOPO IRAK004M15 BC001282 NM_006353  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR048432 ARe21B08 pKA1U5 NM_006353.2  
GGCCTTCCTGTTCCTGGCGGAGCCGGGCTCCGCTCGTCTTCTCTGTCTTAGGGCTGGTGC
HKR079376 ARe98H08 pKA1U5 NM_006353.2  
GGTTCCTGGCGGAGCCGGGCTCCGCTCGTCTTCTCTGTCTTAGGGCTGGTGCTGGCCCTG
HKR368902 RBd22E06 pGCAP10 NM_006353.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl