Prev. | 

RIKEN DNA Bank Human Resource - ZBTB18

Gene ID NCBI Gene 10472 |  KEGG hsa:10472
Gene Symbol ZBTB18
Protein Name zinc finger and BTB domain containing 18
Synonyms C2H2-171|MRD22|RP58|TAZ-1|ZNF238
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018909 IRAK047E13 pBluescriptR BC036677 NM_205768 Full/var
HGX069866 IRAK174L02 pCMV-SPORT6 BC078175 NM_006352 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041455 W01A103K15 pENTR-TOPO IRAK047E13 BC036677 NM_205768  
HGE041461 W01A103K21 pENTR-TOPO IRAK047E13 BC036677 NM_205768  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR381227 RBd53B03 pGCAP10 NM_205768.2  
GGAGGCGGAGGACGCGGCGGCGGCGGGGACGCGGTGACTTAGGGNCGCTCCGTGGCTTTT
HKR471065 RBdS177L01 pGCAP10 NM_205768.2  
GGTCTGGGGTTAGGATAAAGTTTTAGTCTGTCTTGGGCAAAGTGTAGAAGAACAAGAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl