Prev. |  KEGG KO K04798 > 

RIKEN DNA Bank Human Resource - PFDN6

Gene ID NCBI Gene 10471 |  KEGG hsa:10471
Gene Symbol PFDN6
Protein Name prefoldin subunit 6
Synonyms H2-KE2|HKE2|KE-2|PFD6
Ortholog resources KEGG ortholog (KEGG orthology K04798) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033028 IRAK082J12 pCMV-SPORT6 BC039033 NM_014260 Full
HGX054338 IRAK135O02 pCMV-SPORT6 BC059783 NM_014260 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162104 ARi05E08 pGCAP10 NM_014260.2  
GGTTTACTTCCGGGTTTATTACTACTGAAGGAAGAACGCCAGATCAGAAAAGGGAGCTCA
HKR328006 RBb20A06 pKA1U5 NM_014260.2  
GGTTATTACTACTGAAGGAAGAACGCCAGATCAGAAAAGGGAGCTCAGGTACCTTCCAGA
HKR331674 RBb29D02 pGCAP1 NM_014260.2  
GATTACTACTGAAGGAAGAACGTGAGTAGGCCAGATCAGAAAAGGGAGCTCAGGTACCTT
HKR408851 RBdS022C03 pGCAP10 NM_014260.2  
TCTACTGAAGGAAGAACGTGAGTAGGCCAGATCAGAAAAGGGAGCTCAGGTACCTTCCAG
HKR428254 RBdS070K14 pGCAP10 NM_014260.2  
GAATTGATTACTACTGAAGGAAGAACGCCAGATCAGAAAAGGGAGCTCAGGTACCTTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl