Prev. |  KEGG KO K11663 > 

RIKEN DNA Bank Human Resource - ZNHIT1

Gene ID NCBI Gene 10467 |  KEGG hsa:10467
Gene Symbol ZNHIT1
Protein Name zinc finger HIT-type containing 1
Synonyms CG1I|ZNFN4A1
Ortholog resource in our bank

  ZNHIT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005058 IRAK012K18 pCMV-SPORT6 BC010454 NM_006349 Partial
HGY095739 IRAL039F19 pOTB7 BC017333 NM_006349 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058876 ARe47D04 pKA1U5 NM_006349.2  
GGACAGTTGTGTTTGTGCCAATGGTGGAGAAGAAAACTTCGGTTCGCTCCCAGGACCCCG
HKR082906 ARf07E10 pKA1U5 NM_006349.2  
GAGCAGTTTCTTCCGACAGTTGTGTTGTGCCAATGGTGGAGAAGAAAACTTCGGTTCGCT
HKR390928 RBd77F08 pGCAP10 NM_006349.2  
GCTTCCGACAGTTGTGTTGTGCCAATGGTGGAGAAGAAAACTTCGGTTCGCTCCCAGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl