Prev. |  KEGG KO K14696 > 

RIKEN DNA Bank Human Resource - SLC30A9

Gene ID NCBI Gene 10463 |  KEGG hsa:10463
Gene Symbol SLC30A9
Protein Name solute carrier family 30 member 9
Synonyms BILAPES|C4orf1|GAC63|HUEL|ZNT9
Ortholog resource in our bank

  SLC30A9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008293 IRAK020M05 pCMV-SPORT6 BC016949 NM_006345 Full/var
HGY082557 IRAL006G13 pOTB7 BC000240 NM_006345 Full/var
HGY086893 IRAL017D21 pOTB7 BC007732 NM_006345 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045674 ARe14D02 pKA1U5 NM_006345.3  
GAGGCAGCTTGTGGCGGCGAAGCCATCGGGTGTTCGCCTGATGTCCAGGTCTATGGAGCT
HKR374829 RBd37B05 pGCAP10 NM_006345.3  
GAGGCAGCTTGTGGCGGCGAAGCCATCGGTGTTCGCTGATGTCCAGTCTATGGAGTCAGT
HKR375257 RBd38C09 pGCAP10 NM_006345.3  
GCCGGGTCACCCAGGCAGCTTGTGGCGGCGAAGCCATCGGTGTTCGCTGATGTCCAGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl