Prev. |  KEGG KO K14283 > 

RIKEN DNA Bank Human Resource - TACC3

Gene ID NCBI Gene 10460 |  KEGG hsa:10460
Gene Symbol TACC3
Protein Name transforming acidic coiled-coil containing protein 3
Synonyms ERIC-1|ERIC1|Tacc4|maskin
Ortholog resource in our bank

  TACC3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR321778 RBb04H10 pKA1U5 NM_006342.1  
GGTTTGAAACTCCGGCGCGCCGGCGGCCATCAAGGGNTAGAAGCGCGGCGGCGGTAGCAG
HKR334946 RBb37G02 pGCAP1 NM_006342.1  
TGATCAAGGGCTAGAAGCGCGGCGGCGGTAGCAGCCAGGCTTGGCCCCCGGCGTGGAGCA
HKR376433 RBd41B09 pGCAP10 NM_006342.1  
GGGCGTTTGAAACTCCGGCGCGCCGGCGGCCATCAAGGGCTAGAAGCGCGGCGGCGGTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl