Prev. |  KEGG KO K20732 > 

RIKEN DNA Bank Human Resource - GPNMB

Gene ID NCBI Gene 10457 |  KEGG hsa:10457
Gene Symbol GPNMB
Protein Name glycoprotein nmb
Synonyms HGFIN|NMB
Ortholog resources KEGG ortholog (KEGG orthology K20732) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027447 IRAK068K07 pCMV-SPORT6 BC032783 NM_001005340 Full
HGY096997 IRAL042I05 pOTB7 BC025297 NM_002510 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050826 ARe27B02 pKA1U5 NM_002510.2  
GGCCAGAAGAACACTGNTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCT
HKR059327 ARe48F07 pKA1U5 NM_002510.2  
GAGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAG
HKR075283 ARe88D11 pKA1U5 NM_002510.2  
GAGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAG
HKR162449 ARi06C01 pGCAP10 NM_002510.2  
GAGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAG
HKR164429 ARi11B05 pGCAP10 NM_002510.2  
GAGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAG
HKR166879 ARi17D07 pGCAP10 NM_002510.2  
AGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAGT
HKR176032 ARi40B08 pGCAP10 NM_002510.2  
GAGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAG
HKR235271 ARiS088C23 pGCAP10 NM_002510.2  
GAGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTTGAG
HKR264707 ARiS161M19 pGCAP10 NM_002510.2  
GGCCAGAAGAACACTGTTGCTCTTGGTGGACGGGCCCAGAGGAATTCAGAGTTAAACCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl