Prev. |  KEGG KO K16220 > 

RIKEN DNA Bank Human Resource - HAX1

Gene ID NCBI Gene 10456 |  KEGG hsa:10456
Gene Symbol HAX1
Protein Name HCLS1 associated protein X-1
Synonyms HCLSBP1|HS1BP1|SCN3
Ortholog resource in our bank

  HAX1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008821 IRAK022A21 pCMV-SPORT6 BC015209 NM_006118 Full
HGY086531 IRAL016F11 pDNR-LIB BC005240 NM_006118 Full
HGY092536 IRAL031F16 pDNR-LIB BC014314 NM_006118 Full
HGY093032 IRAL032J16 pDNR-LIB BC016730 NM_006118 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001017 W01A002J01 pENTR-TOPO IRAL016F11 BC005240 NM_006118  
HGE001019 W01A002J03 pENTR-TOPO IRAL016F11 BC005240 NM_006118  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR122923 ARh07F03 pGCAP1 NM_006118.3  
GTCGCTCAATTTCTCACAGGGCTGCGCAGGTTTCCCCCGTCTGCGAATGGAC
HKR373305 RBd33E09 pGCAP10 NM_006118.3  
GGCTCAATTTCTCACAGGGCTGCGCAGGTTTCCCCCGTCTGCGAATGGACCACTGGAGGG
HKR377308 RBd43E12 pGCAP10 NM_006118.3  
GAGGGCTGCGCAGGTTTCCCCCGTCTGCGAATGGACCACTGGAGGGGTTCAAAGGTTCGC
HKR428158 RBdS070G14 pGCAP10 NM_006118.3  
GGCTGACGCCTCGCTCAATTTCTCACAGGGCTGCGCAGGTTTCCCCCGTCTGCGAATGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl