Prev. |  KEGG KO K13239 > 

RIKEN DNA Bank Human Resource - ECI2

Gene ID NCBI Gene 10455 |  KEGG hsa:10455
Gene Symbol ECI2
Protein Name enoyl-CoA delta isomerase 2
Synonyms ACBD2|DRS-1|DRS1|HCA88|PECI|dJ1013A10.3
Ortholog resource in our bank

  ECI2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03856 SEREX clone NGO-St-117 (ID 1328) #1 SEREX clone NGO-St-117 (ID 1328) #1
RDB03892 SEREX clone NGO-St-117 (ID 1328) #2 SEREX clone NGO-St-117 (ID 1328) #2
RDB04465 SEREX clone BRC-Co-7 #1 SEREX clone BRC-Co-7 #1
RDB04609 SEREX clone NGO-Br-2 (ID 802) #1 SEREX clone NGO-Br-2 (ID 802) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011519 IRAK028N07 pCMV-SPORT6 BC034702 NM_206836 Full
HGX027292 IRAK068D20 pCMV-SPORT6 BC033841 NM_206836 Full
HGY085003 IRAL012I11 pOTB7 BC002668 NM_206836 Full
HGY089498 IRAL023M10 pOTB7 BC017474 NM_206836 Full
HGY092853 IRAL032C05 pDNR-LIB BC016781 NM_206836 Full
HGY097103 IRAL042M15 pOTB7 BC025287 NM_206836 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR279483 ARiS198L19 pGCAP10 NM_006117.2  
GNGCCGCCCNNGGGANGGCGNNGGCGNNCTTCGGCTNNGGAGACNGGCGCGGCGTTCGTG
HKR363345 RBd08G01 pGCAP10 NM_006117.2  
GAGAGCCGCCCAAGGGATGGCGATGGCGTACTTGGCTTGGAGACTGGCGCGGCGTTCGTG
HKR403039 RBdS007J23 pGCAP10 NM_006117.2  
GAGCCGCCCAAGGGATGGCGATGGCGTACTTGGCTTGGAGACTGGCGCGGCGTTCGTGTC
HKR432621 RBdS081J05 pGCAP10 NM_006117.2  
GACCCCCGAGCCCCCGCAGCCCTAGAGCCGCCCAAGGGATGGCGATGGCGTACTTGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl