Prev. |  KEGG KO K04403 > 

RIKEN DNA Bank Human Resource - TAB1

Gene ID NCBI Gene 10454 |  KEGG hsa:10454
Gene Symbol TAB1
Protein Name TGF-beta activated kinase 1 (MAP3K7) binding protein 1
Synonyms 3'-Tab1|MAP3K7IP1
Featured content NF-kappa B signaling pathway (human)
Ortholog resource in our bank

  TAB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17340 pcDNA3-human TAB1 Expression vector of human TAB1.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025954 IRAK064O18 pCMV-SPORT6 BC038582 NM_006116 Full
HGX043184 IRAK107P24 pCMV-SPORT6 BC050554 NM_006116 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR471113 RBdS177N01 pGCAP10 NM_006116.2  
GGCGCTCCCGCAGGGGTTCCTCCAAGATGGCGGCGCAGAGGAGGAGCTTGCTGCAGAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl