Prev. |  KEGG KO K07508 > 

RIKEN DNA Bank Human Resource - ACAA2

Gene ID NCBI Gene 10449 |  KEGG hsa:10449
Gene Symbol ACAA2
Protein Name acetyl-CoA acyltransferase 2
Synonyms DSAEC
Ortholog resources KEGG ortholog (KEGG orthology K07508) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083765 IRAL009G21 pOTB7 BC001918 NM_006111 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222189 ARiS055H21 pGCAP10 NM_006111.2  
TGGCTCTCGGGGCGCCACCCACGCTCTTGAAATCTGGGTGATTGCGAGCGGCCGCTCAGC
HKR243664 ARiS109C16 pGCAP10 NM_006111.2  
GACACCACAGACCCGCGCCGCCGACGACCCAGCAGCCGCCATGGCTCTGCTCCGAGGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl