Prev. | 

RIKEN DNA Bank Human Resource - CDC42EP2

Gene ID NCBI Gene 10435 |  KEGG hsa:10435
Gene Symbol CDC42EP2
Protein Name CDC42 effector protein 2
Synonyms BORG1|CEP2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094672 IRAL036L08 pDNR-LIB BC022337 NM_006779 Full
HGY103398 IRAL058I06 pOTB7 BC075834 NM_006779 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044556 ARe11G12 pKA1U5 NM_006779.2  
GGTAAGTTCACCGCCGGTCGGGTCCGGCCGCCGCGCTGATCCAGCTCCTGAGACCTTGCT
HKR058478 ARe46D06 pKA1U5 NM_006779.2  
GCTGAAAGCCCGAGAGCCAGAGGGAAACAAACGCCGGCGCTGACAGGGGCCGCCAGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl