Prev. | 

RIKEN DNA Bank Human Resource - CFDP1

Gene ID NCBI Gene 10428 |  KEGG hsa:10428
Gene Symbol CFDP1
Protein Name craniofacial development protein 1
Synonyms BCNT|BUCENTAUR|CENP-29|CP27|SWC5|Yeti|p97
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001378 IRAK003H10 pCMV-SPORT6 BC000991 NM_006324 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048058 ARe20C10 pKA1U5 NM_006324.2  
GAGCTGCCGTCGCCGCCGCCGGGGCTCTATGGTCTCTCCCTAGAGCTTTGCCGTTGGAGG
HKR340805 RBb52A05 pGCAP1 NM_006324.2  
GGTAGTACTCTCTGCGCATGTGCAAAGCGCTGTTCGGGGGCCGCCCTAGCTGCCGTCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl