Prev. |  KEGG KO K00999 > 

RIKEN DNA Bank Human Resource - CDIPT

Gene ID NCBI Gene 10423 |  KEGG hsa:10423
Gene Symbol CDIPT
Protein Name CDP-diacylglycerol--inositol 3-phosphatidyltransferase
Synonyms PIS|PIS1
Ortholog resource in our bank

  CDIPT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081695 IRAL004D23 pOTB7 BC001444 NM_006319 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021212 W01A053A12 pENTR-TOPO flj0043e14 AK097691 NM_006319  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222353 ARiS055O17 pGCAP10 NM_006319.3  
GGCAGCTGGAGGCCCGGAGCGCCTGCGGGGCTGGCAGAGGCGAGGGAGGTTGCGGGTAGG
HKR238521 ARiS096F01 pGCAP10 NM_006319.3  
GGGAGCGCCTGCGGGGCTGGCAGAGGCGAGGGAGGTTGCGGGTAGGAAGGGCGGACTGCG
HKR238745 ARiS096O09 pGCAP10 NM_006319.3  
GGGAGCGCCTGCGGGGCTGGCAGAGGCGAGGGAGGTTGCGGGTAGGAAGGGCGGACTGCG
HKR387356 RBd68G12 pGCAP10 NM_006319.3  
AATTTTNCAACGACGGGCGCGGAGGAGGAGGTTCCCGGAAGCCACGCGCAGCTGGAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl