Prev. |  KEGG KO K13099 > 

RIKEN DNA Bank Human Resource - CD2BP2

Gene ID NCBI Gene 10421 |  KEGG hsa:10421
Gene Symbol CD2BP2
Protein Name CD2 cytoplasmic tail binding protein 2
Synonyms FWP010|LIN1|PPP1R59|Snu40|U5-52K
Ortholog resource in our bank

  CD2BP2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080480 IRAL001D08 pOTB7 BC000495 NM_006110 Full
HGY083905 IRAL009M17 pOTB7 BC001947 NM_006110 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055277 ARe38D05 pKA1U5 NM_006110.2  
GGCAGTCCTCTTCCGGGTGATGGCGGCCGGGCTGCCCCGGATGTAGCCCTGGCGCAAGCA
HKR336407 RBb41A07 pGCAP1 NM_006110.2  
GGGCCGGGTGCCCCGGAATGTAGCCCTGGCGCAAGCATCTCTTCTTTTTTCCACCTCGCC
HKR371601 RBd29A01 pGCAP10 NM_006110.2  
GAAGCATCTCTTCTTTTTTCCACCTCGCCTTCCGCGGATTCCCAGCTTGAGAAACACCTC
HKR402813 RBdS007A13 pGCAP10 NM_006110.2  
GAGTCCTCTTCCGGGTGATGGCGGCCGGGTGCCCCGGATGTAGCCCTGGCGCAAGCATCT
HKR470933 RBdS177F13 pGCAP10 NM_006110.2  
GCCCCGGATGTAGCCCTGGCGCAAGCATCTCTTCTTTTTTCCACCTCGCCTTCCGCGGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl