Prev. | 

RIKEN DNA Bank Human Resource - SPON1

Gene ID NCBI Gene 10418 |  KEGG hsa:10418
Gene Symbol SPON1
Protein Name spondin 1
Synonyms VSGP/F-spondin|f-spondin
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX017001 IRAK042I09 pCMV-SPORT6 BC019825 NM_006108 Partial/var
HGY031042 IRAK077K02 pBluescriptR BC041974 NM_006108 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR363297 RBd08E01 pGCAP10 NM_006108.2 done
GGAGCTCCCTCTCTCCGCCGCGCCTCCGCCAGGTCGCGCCTTCGTCGGGACCACTTCGGG
HKR453090 RBdS132M02 pGCAP10 NM_006108.2 done
GGCAGCTCCGCGGCCGCCAAGCCGAGGCGGGCACGGTCTCCGAGTCGCGGACGCCAGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl