Prev. |  KEGG KO K16687 > 

RIKEN DNA Bank Human Resource - YAP1

Gene ID NCBI Gene 10413 |  KEGG hsa:10413
Gene Symbol YAP1
Protein Name Yes associated protein 1
Synonyms COB1|YAP|YAP2|YAP65|YKI
Ortholog resources KEGG ortholog (KEGG orthology K16687) in the DNA Bank
Featured content Hippo signaling (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13968 pFLAG-human yes-associated protein (YAP)1 Expression vector of FLAG-tagged YAP1.
RDB14395 pLL3.7-FLAG-YAP1 Expression vector of FLAG-tagged human YAP1 with GFP marker.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031871 IRAK079L07 pCMV-SPORT6 BC038235 NM_006106 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071249 ARe78C01 pKA1U5 NM_006106.3  
GCCCGGCCCTGAGAGCGAGGACAGCGCCGCCCGGCCCGCAGCCGTCGCCGCTTCTCCACC
HKR181325 ARi53F05 pGCAP10 NM_006106.3  
GCTCAGTCGGGCGCAGCCGCCGCCAGGGAAAAGAAAGGGAGGAAGGAAGGAACAAGAAAA
HKR276454 ARiS191C06 pGCAP10 NM_006106.3  
GCTCAGTCGGGCGCAGCCGCCGCCAGGGAAAAGAAAGGGAGGAAGGAAGGAACAAGAAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.07.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl