Prev. |  KEGG KO K06566 > 

RIKEN DNA Bank Human Resource - IFITM3

Gene ID NCBI Gene 10410 |  KEGG hsa:10410
Gene Symbol IFITM3
Protein Name interferon induced transmembrane protein 3
Synonyms 1-8U|DSPA2b|IP15
Ortholog resources KEGG ortholog (KEGG orthology K06566) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15717 p3xFLAGCMV_hIFITM3 Expression vector of human interferon induced transmembrane protein 3 (IFITM3).

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001427 IRAK003J11 pCMV-SPORT6 BC006794 NM_021034 Full/var
HGY088751 IRAL021O15 pDNR-LIB BC008417 NM_021034
HGY094304 IRAL035M16 pDNR-LIB BC022439 NM_021034
HGY103152 IRAL057O16 pDNR-LIB BC070243 NM_021034 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064945 ARe62G01 pKA1U5 NM_021034.2  
GACTGGGGAAAGGGAGGGCTCACTGAGAACCATCCCAGCTAACCCGACCGCCGCTGGTCT
HKR072525 ARe81F05 pKA1U5 NM_021034.2  
GGGACACCATGAATCACACTGNTCCAAACCTTCTTCTCTCCTGTCAACAGTGGCCAGCCC
HKR073210 ARe83A10 pKA1U5 NM_021034.2  
GGAGAACCATCCCAGNTAACCCGACCACCGCTGGTCTTCGCTGGACACCATGAATCACAC
HKR079705 ARe99E09 pKA1U5 NM_021034.2  
GGCTGGACACCATGAATCACACTGTCCAAACCTTCTTCTCTCCTGTCAACAGTGGCCAGC
HKR167629 ARi19B05 pGCAP10 NM_021034.2  
GGGAGGGCTCACTGAGAACCATCCCAGTAACCCGACCGCCGCTGGTCTTCGCTGGACACC
HKR235051 ARiS087K11 pGCAP10 NM_021034.2  
GGAGGGCTCACTTGANAACCATCCCAGTAACCCGACCACCGCTGGTCTTCGCTGGACACC
HKR264565 ARiS161G21 pGCAP10 NM_021034.2  
GACTGGGGAAAGGGAGGGCTCACTGAGAACCATCCCAGTAACCCGACCACCGCTGGTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.10.31

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl