Prev. |  KEGG KO K17272 > 

RIKEN DNA Bank Human Resource - BASP1

Gene ID NCBI Gene 10409 |  KEGG hsa:10409
Gene Symbol BASP1
Protein Name brain abundant membrane attached signal protein 1
Synonyms CAP-23|CAP23|NAP-22|NAP22
Ortholog resources KEGG ortholog (KEGG orthology K17272) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080634 IRAL001J18 pOTB7 BC000518 NM_006317 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE038531 W01A096F11 pENTR-TOPO IRAL001J18 BC000518 NM_006317  
HGE038537 W01A096F17 pENTR-TOPO IRAL001J18 BC000518 NM_006317  
HGE038543 W01A096F23 pENTR-TOPO IRAL001J18 BC000518 NM_006317  
HGE047734 W01A119F14 pENTR-TOPO IRAL001J18 BC000518 NM_006317  
HGE047736 W01A119F16 pENTR-TOPO IRAL001J18 BC000518 NM_006317  
HGE047742 W01A119F22 pENTR-TOPO IRAL001J18 BC000518 NM_006317  
HGE047744 W01A119F24 pENTR-TOPO IRAL001J18 BC000518 NM_006317  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041603 ARe04A03 pKA1U5 NM_006317.3  
GAAGTTAGCGGCAGCCTTCGACNACANCTGGCGCGCANNTCTTCCAACTGGGGTCCACGC
HKR046025 ARe15B01 pKA1U5 NM_006317.3  
GAGTAGCGGCAGCGGCGACGACGGCGGCGGCAGCGCTCCAACTGGCTCCTCGCTCCGGGC
HKR218265 ARiS045L01 pGCAP10 NM_006317.3  
GAGCGGCAGCGGCGACGACGGCGGCGGCAGCGCTCCAACTGGCTCCTCGCTCCGGGCTCC
HKR279562 ARiS198P02 pGCAP10 NM_006317.3  
GGGTAGCGGCAGCGGCGACGACGGCGGCGGCAGCGCTCCAACTGGCTCCTCGCTCCGGGC
HKR334055 RBb35C07 pGCAP1 NM_006317.3  
GAGTAGCGGCAGCGGCGACGACGGCGGCGGCAGCGCTCCAACTGGCTCCTCGCTCCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl