Prev. |  KEGG KO K16064 > 

RIKEN DNA Bank Human Resource - PIAS3

Gene ID NCBI Gene 10401 |  KEGG hsa:10401
Gene Symbol PIAS3
Protein Name protein inhibitor of activated STAT 3
Synonyms ZMIZ5
Featured content Jak-STAT signaling pathway (human)
Ortholog resource in our bank

  PIAS3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025900 IRAK064M12 pCMV-SPORT6 BC030556 NM_006099 Full
HGY083353 IRAL008G09 pOTB7 BC001154 NM_006099 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002955 W01A007G11 pENTR-TOPO IRAL008G09 BC001154 NM_006099  
HGE002959 W01A007G15 pENTR-TOPO IRAL008G09 BC001154 NM_006099  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184828 ARi62B04 pGCAP10 NM_006099.3  
GATTTGCGGCCGGCGCCAGGGTGGAGAGTTGTGCGCCGGTCCCTGGGCCTGAGCTCCGGC
HKR430178 RBdS075H10 pGCAP10 NM_006099.3  
GGGAGCTCCGGCCCGGGCGGAGCCGCGGCCGCCGCGTCCGGCTGCTGGACCGAACTTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl