Prev. |  KEGG KO K03357 > 

RIKEN DNA Bank Human Resource - ANAPC10

Gene ID NCBI Gene 10393 |  KEGG hsa:10393
Gene Symbol ANAPC10
Protein Name anaphase promoting complex subunit 10
Synonyms APC10|DOC1
Ortholog resource in our bank

  ANAPC10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086525 IRAL016F05 pDNR-LIB BC005217 NM_014885 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037252 W01A093C04 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE037254 W01A093C06 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE037256 W01A093C08 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE037258 W01A093C10 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE037260 W01A093C12 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE037266 W01A093C18 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE037268 W01A093C20 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE045503 W01A113M15 pENTR-TOPO IRAL016F05 BC005217 NM_014885  
HGE045505 W01A113M17 pENTR-TOPO IRAL016F05 BC005217 NM_014885  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR395325 RBd88F05 pGCAP10 NM_014885.3  
GATTGAGCTGCGACCCTTGTTCAACGCCGTTGGCGAAGCCAGCTGCTGGAGGTGCCGAGA
HKR405733 RBdS014F13 pGCAP10 NM_014885.3  
GAGCTGCTGGAGGTGCCGAGAATCTGAGTTTCGGCAAGCAGCCAGGTCTGGAAACTGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl