Prev. |  KEGG KO K21361 > 

RIKEN DNA Bank Human Resource - CITED2

Gene ID NCBI Gene 10370 |  KEGG hsa:10370
Gene Symbol CITED2
Protein Name Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2
Synonyms ASD8|MRG-1|MRG1|P35SRJ|VSD2
Ortholog resources KEGG ortholog (KEGG orthology K21361) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085578 IRAL013P18 pOTB7 BC004377 NM_006079 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE018300 W01A045M12 pENTR-TOPO IRAL013P18 BC004377 NM_006079  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042156 ARe05G12 pKA1U5 NM_006079.3  
TTGACAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGG
HKR043370 ARe08H02 pKA1U5 NM_006079.3  
GACAGCTCATTGTTTGGCAGCTGCCGGGCGGTCCTGNNGAGCTGTGAGGGCAACGGAGGG
HKR046451 ARe16C03 pKA1U5 NM_006079.3  
GACAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGGGG
HKR077231 ARe93B07 pKA1U5 NM_006079.3  
GACACAGCTCATTGCTTGGCAGCTGCCGGGCGGTCCTGNCGAGCTGTGAGGGCAACGGAG
HKR078177 ARe95H09 pKA1U5 NM_006079.3  
GACAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGGGG
HKR170898 ARi27E02 pGCAP10 NM_006079.3  
GACACAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGG
HKR175301 ARi38E05 pGCAP10 NM_006079.3  
GAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGGGGAA
HKR186176 ARi65H08 pGCAP10 NM_006079.3  
GACAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGGGG
HKR277744 ARiS194F24 pGCAP10 NM_006079.3  
GACAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGGGG
HKR277956 ARiS194O20 pGCAP10 NM_006079.3  
GACAGCTCATTGTTGGCAGCTGCCGGGCGGTCCTGCCGAGCTGTGAGGGCAACGGAGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl