Prev. |  KEGG KO K22827 > 

RIKEN DNA Bank Human Resource - MICU1

Gene ID NCBI Gene 10367 |  KEGG hsa:10367
Gene Symbol MICU1
Protein Name mitochondrial calcium uptake 1
Synonyms CALC|CBARA1|EFHA3|MPXPS|ara CALC
Ortholog resource in our bank

  MICU1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010453 IRAK026C05 pCMV-SPORT6 BC016641 NM_006077 Full/var
HGY081270 IRAL003C22 pOTB7 BC004190 NM_006077 Full/var
HGY084014 IRAL010A14 pOTB7 BC004216 NM_006077 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174506 ARi36E10 pGCAP10 NM_006077.2  
GAGAGTCACGTGAGAGTGGGCGGAGGGGGTGGAGGTTTGTCTCCGCTGTTTCATCTCTAT
HKR395746 RBd89G02 pGCAP10 NM_006077.2  
GGGTCTCCGCTGTTTCATCTCTATGGCTGTCAGAGGTGGGCGGCTTTGACCGAGAGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl