Prev. | 

RIKEN DNA Bank Human Resource - HMG20B

Gene ID NCBI Gene 10362 |  KEGG hsa:10362
Gene Symbol HMG20B
Protein Name high mobility group 20B
Synonyms BRAF25|BRAF35|HMGX2|HMGXB2|PP7706|SMARCE1r|SOXL|pp8857
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081835 IRAL004J19 pOTB7 BC002552 NM_006339 Full
HGY085426 IRAL013J10 pOTB7 BC004408 NM_006339 Full
HGY085503 IRAL013M15 pOTB7 BC003505 NM_006339 Full
HGY096267 IRAL040L03 pOTB7 BC021585 NM_006339 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE009558 W01A023O22 pENTR-TOPO IRAL013J10 BC004408 NM_006339  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057722 ARe44F02 pKA1U5 NM_006339.2  
GAAAGTTTCTTTGGAGGTCCGGCCCGGAGCGGCCATGTTCCCACGGCCCCAAGCAGCCCG
HKR260342 ARiS150O06 pGCAP10 NM_006339.2  
TGGGGAAAGTTTCTTTGGAGGTCCGGCCCGGAGCGGCCATGTCCCACGGCCCCAAGCAGC
HKR264456 ARiS161C08 pGCAP10 NM_006339.2  
GGGGGAAAGTTTCTTTGGAGGTCCGGCCCGGAGCGGCCATGTCCCACGGCCCCAAGCAGC
HKR373253 RBd33C05 pGCAP10 NM_006339.2  
GGCGGGCGGTTGGTTGGAGCGTCGCGCAGTCGGGAGGTCCGGGAAAGTTTCTTTGGAGGT
HKR390548 RBd76G04 pGCAP10 NM_006339.2  
GGGGGCGGCCGACGGGGGCGGGCTGCGGGCGGTTGGTTGGAGCGTCGCGCAGTCGGGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl