Prev. |  KEGG KO K01867 > 

RIKEN DNA Bank Human Resource - WARS2

Gene ID NCBI Gene 10352 |  KEGG hsa:10352
Gene Symbol WARS2
Protein Name tryptophanyl tRNA synthetase 2, mitochondrial
Synonyms NEMMLAS|TrpRS|mtTrpRS
Ortholog resource in our bank

  WARS2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032897 IRAK082E01 pCMV-SPORT6 BC039889 NM_201263 Full
HGY042721 IRAK106N09 pBluescript BC044575 NM_015836 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047704 ARe19E08 pKA1U5 NM_015836.3  
GCTCAAGATGGCGCTGCACTCAATGCGGAAAGCGCGTGAGCGCTGGAGCTTCATCCGGGC
HKR167233 ARi18B09 pGCAP10 NM_015836.3  
GAGTCCCGGCTGCCCCCTCCGCCACCGCCGCCGCCCGCCGGCAGGTTCCCTGGTCAGCGT
HKR372882 RBd32D10 pGCAP10 NM_015836.3  
GATCCGGGCACTTCATAAGGGATCCGCAGCTGCTCCCGCTCTCCAGAAAGACAGCAAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl