RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ABCA7

Gene ID	NCBI Gene 10347 \| KEGG hsa:10347
Gene Symbol	ABCA7
Protein Name	ATP binding cassette subfamily A member 7
Synonyms	ABCA-SSN\|ABCX\|AD9

Ortholog resource in our bank

  ABCA7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR042036	ARe05B12	pKA1U5	NM_019112.3	VA
HKR042036	GAAGGGGCGGCGCGCTCCCTGCCTGCTGCTGGGCGGAGGGAAGGCGGCAAGAGCTGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl