Prev. |  KEGG KO K05645 > 

RIKEN DNA Bank Human Resource - ABCA7

Gene ID NCBI Gene 10347 |  KEGG hsa:10347
Gene Symbol ABCA7
Protein Name ATP binding cassette subfamily A member 7
Synonyms ABCA-SSN|ABCX|AD9
Ortholog resource in our bank

  ABCA7

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042036 ARe05B12 pKA1U5 NM_019112.3 done
GAAGGGGCGGCGCGCTCCCTGCCTGCTGCTGGGCGGAGGGAAGGCGGCAAGAGCTGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl