Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ABCA7

Gene ID (NCBI) 10347
Gene Symbol ABCA7
Protein Name ATP-binding cassette, sub-family A (ABC1), member 7
Synonyms ABCA-SSN|ABCX
Databases KEGG link 01 |  NCBI Gene link 01


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR042036 ARe05B12 pKA1U5 NM_019112.3
GAAGGGGCGGCGCGCTCCCTGCCTGCTGCTGGGCGGAGGGAAGGCGGCAAGAGCTGCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl