Prev. |  KEGG KO K11999 > 

RIKEN DNA Bank Human Resource - TRIM22

Gene ID NCBI Gene 10346 |  KEGG hsa:10346
Gene Symbol TRIM22
Protein Name tripartite motif containing 22
Synonyms GPSTAF50|RNF94|STAF50
Ortholog resource in our bank

  TRIM22

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07382 pGL4-phTRIM22 Promoter collection, Human TRIM22 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027971 IRAK069P11 pCMV-SPORT6 BC035582 NM_006074 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002265 W01A005L01 pENTR-TOPO IRAK069P11 BC035582 NM_006074 done
HGE002267 W01A005L03 pENTR-TOPO IRAK069P11 BC035582 NM_006074  
HGE002269 W01A005L05 pENTR-TOPO IRAK069P11 BC035582 NM_006074  
HGE002271 W01A005L07 pENTR-TOPO IRAK069P11 BC035582 NM_006074  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048050 ARe20C02 pKA1U5 NM_006074.3  
TGAGTGACTGAGTGCCTTGCCAGTACAGCAGATGCTAGAACATAATGTAGCATTACTTTC
HKR056954 ARe42G10 pKA1U5 NM_006074.3  
TGAGTACAGCAGATGCTAGAACATAATGTAGCATTACTTTCCCCAGGGNTTTATTGTTAT
HKR165660 ARi14C12 pGCAP10 NM_006074.3  
GAGTGACTGAGTGCCTTGCCAGTACAGCAGATGCTAGAACATAATGTAGCATTACTTTCC
HKR168808 ARi22A08 pGCAP10 NM_006074.3  
GGGAGACCAGCCCTCTGGCTTGGTGAGTGAATCTGGTTTACACCGGCTCCTGCCCTGCCT
HKR188452 ARi71C04 pGCAP10 NM_006074.3  
GAGTAGTGACTGAGTGCCTTGCCAGTACAGCAGATGCTAGAACATAATGTAGCATTACTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl