Prev. |  KEGG KO K21096 > 

RIKEN DNA Bank Human Resource - CCL26

Gene ID NCBI Gene 10344 |  KEGG hsa:10344
Gene Symbol CCL26
Protein Name C-C motif chemokine ligand 26
Synonyms IMAC|MIP-4a|MIP-4alpha|SCYA26|TSC-1
Ortholog resource in our bank

  CCL26

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053326 ARe33F06 pKA1U5 NM_006072.4 Full done
GGGGAGAAACCTGAGAAGGGCCTGATTTGCAGCATCATGATGGGCCTCTCCTTGGCCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl