Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PCGF3

Gene ID (NCBI) 10336
Gene Symbol PCGF3
Protein Name polycomb group ring finger 3
Synonyms DONG1|RNF3|RNF3A
Databases KEGG hsa:10336 |  NCBI Gene 10336
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11488)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR444078 RBdS110D06 pGCAP10 NM_006315.4  
GGACGCGGCGCTCGGCTCGGCTCGGGCATTTCCGCCTCTTTGTTTTAAACTCCGGACGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl