Prev. |  KEGG KO K11488 > 

RIKEN DNA Bank Human Resource - PCGF3

Gene ID NCBI Gene 10336 |  KEGG hsa:10336
Gene Symbol PCGF3
Protein Name polycomb group ring finger 3
Synonyms DONG1|RNF3|RNF3A
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Ortholog resource in our bank

  PCGF3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR444078 RBdS110D06 pGCAP10 NM_006315.4  
GGACGCGGCGCTCGGCTCGGCTCGGGCATTTCCGCCTCTTTGTTTTAAACTCCGGACGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl