Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AKR1A1

Gene ID (NCBI) 10327
Gene Symbol AKR1A1
Protein Name aldo-keto reductase family 1, member A1 (aldehyde reductase)
Synonyms ALDR1|ALR|ARM|DD3|HEL-S-6
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082134 IRAL005F14 pOTB7 BC000670 NM_153326 Full
HGY086442 IRAL016B18 pDNR-LIB BC005394 NM_153326 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR180484 ARi51D12 pGCAP10 NM_153326.1
TGAGACTTAAGCTGAGGATCGTTGGATCTCTGGCGGGGTGCAGAACTGAGCCCAGGCCAC
HKR078428 ARe96B04 pKA1U5 NM_153326.1
GAGACTTAAGCTGAGGATCGTTGGATCTCTGGCGGGGTGCAGAACTGAGCCCAGGCCACA
HKR205477 ARiS013L13 pGCAP10 NM_153326.1
GCAGTTCGACCTCGAGGATCCAGAGGTGGAGACGGTACTACCTCCCAGCTCTGTTTTCCA
HKR234102 ARiS085E06 pGCAP10 NM_153326.1
GCCCCTTGCACCGCCCACGTGGCCAGCGCCACCTGCCTCATTGTGCCCAGGAGTTCTCCA
HKR320883 RBb02D11 pKA1U5 NM_153326.1
GAGTGAGTGACCAAGTTCCGGCCAGTTCGACCTCGAGGATCCAGAGGTGGAGACGGTACT
HKR326502 RBb16E06 pKA1U5 NM_153326.1
GCTGCCTCATTGTGCCCAGGAGTTCTCCAAACCCGCGCTGCGGAGTGAGTGACCAAGTTC
HKR376075 RBd40D03 pGCAP10 NM_153326.1
GATTTGTGCCCAGGAGTTCTCCAAACCCGCGCTGCGGAGTCCTTCCTCGGGAGGCGGCGA
HKR378076 RBd45D04 pGCAP10 NM_153326.1
GGGAACTTCCCCCTCACCGCCAGACTTAAGCTGAGGATCGTTGGATCTCTGGCGGGGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl