Prev. | 

RIKEN DNA Bank Human Resource - TNIP1

Gene ID NCBI Gene 10318 |  KEGG hsa:10318
Gene Symbol TNIP1
Protein Name TNFAIP3 interacting protein 1
Synonyms ABIN-1|NAF1|VAN|nip40-1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081810 IRAL004I18 pOTB7 BC007666 NM_006058 Full/var
HGY091373 IRAL028H05 pOTB7 BC014008 NM_006058 Full/var
HGY091643 IRAL029B19 pOTB7 BC012133 NM_006058 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235560 ARiS088O24 pGCAP10 NM_006058.3  
GGGGCGGCCCGGCCAGGCCCCCGGCACTTCCTCGTCCTCGGCCCGGGTGCCCTGCCCCCG
HKR276582 ARiS191H14 pGCAP10 NM_006058.3  
GCTCGGCCCGGGTGCCCTGCCCCCGTCCAGGAGCCCTAGGAGTGCTACGGGGGGCCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl