Prev. |  KEGG KO K11985 > 

RIKEN DNA Bank Human Resource - TRAIP

Gene ID NCBI Gene 10293 |  KEGG hsa:10293
Gene Symbol TRAIP
Protein Name TRAF interacting protein
Synonyms RNF206|SCKL9|TRIP
Ortholog resource in our bank

  TRAIP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080503 IRAL001E07 pOTB7 BC000310 NM_005879 Full
HGY083865 IRAL009L01 pOTB7 BC019283 NM_005879 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097625 M01C044B01 pDONR221 MGC11-G01 BC019283 NM_005879  
HGE097673 M01C044D01 pDONR221 MGC11-G01 BC019283 NM_005879  
HGE097721 M01C044F01 pDONR221 MGC11-G01 BC019283 NM_005879  
HGE097769 M01C044H01 pDONR221 MGC11-G01 BC019283 NM_005879  
HGE097817 M01C044J01 pDONR221 MGC11-G01 BC019283 NM_005879  
HGE097865 M01C044L01 pDONR221 MGC11-G01 BC019283 NM_005879  
HGE097913 M01C044N01 pDONR221 MGC11-G01 BC019283 NM_005879  
HGE097961 M01C044P01 pDONR221 MGC11-G01 BC019283 NM_005879  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR462413 RBdS156A13 pGCAP10 NM_005879.2  
GGCGCGTCTACGAAGCCGGACCTGTAGCAGTTTCTTTGGCTGCCTGGGCCCCTTGAGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl