Prev. |  KEGG KO K12825 > 

RIKEN DNA Bank Human Resource - SF3A1

Gene ID NCBI Gene 10291 |  KEGG hsa:10291
Gene Symbol SF3A1
Protein Name splicing factor 3a subunit 1
Synonyms PRP21|PRPF21|SAP114|SF3A120
Ortholog resource in our bank

  SF3A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001810 IRAK004I18 pCMV-SPORT6 BC001976 NM_005877 Full
HGY084970 IRAL012H02 pOTB7 BC007684 NM_005877 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE042739 W01A106O03 pENTR-TOPO IRAK004I18 BC001976 NM_005877  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178026 ARi45B02 pGCAP10 NM_005877.4  
TGGAGCTCGTCGTACTGACCGAGCGGGGAGGCTGTCTTGAGGCGGCACCGCTCACCGACA
HKR323604 RBb09A04 pKA1U5 NM_005877.4  
GATCTTGCGAGCTCGTCGTACTGACCGAGCGGGGAGGCTGTCTTGAGGCGGCACCGCTCA
HKR388456 RBd71C08 pGCAP10 NM_005877.4  
GGCCATCTTGCGAGCTCGTCGTACTGACCGAGCGGGGAGGCTGTCTTGAGGCGGCACCGC
HKR409178 RBdS022P18 pGCAP10 NM_005877.4  
TGGAGCTCGTCGTACTGACCGAGCGGGGAGGCTGTCTTGAGGCGGCACCGCTCACCGACA
HKR470945 RBdS177G01 pGCAP10 NM_005877.4  
TGGAGCTCGTCGTACTGACCGAGCGGGGAGGCTGTCTTGAGGCGGCACCGCTCACCGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl