Prev. |  KEGG KO K03113 > 

RIKEN DNA Bank Human Resource - EIF1B

Gene ID NCBI Gene 10289 |  KEGG hsa:10289
Gene Symbol EIF1B
Protein Name eukaryotic translation initiation factor 1B
Synonyms GC20
Ortholog resource in our bank

  EIF1B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086582 IRAL016H14 pDNR-LIB BC006996 NM_005875 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072084 ARe80D12 pKA1U5 NM_005875.2  
GGAGAAGCCGCAGCGCCGCCTCTTCTCTCGCGCCCTCGCCTCTTCCTCCGCCTCCTCCTT
HKR219756 ARiS049G12 pGCAP10 NM_005875.2  
GGAGAAGCCGCAGCGCCGCCTCTTCTCTCGCGCCCTCGCCTCTTCCTCCGCCTCCTCCTT
HKR238462 ARiS096C14 pGCAP10 NM_005875.2  
GCTCTCGCGCCCTCGCCTCTTCCTCCGCCTCCTCCTTCGCCTCTTCCTGCCTCCTCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl