Prev. |  KEGG KO K12839 > 

RIKEN DNA Bank Human Resource - SMNDC1

Gene ID NCBI Gene 10285 |  KEGG hsa:10285
Gene Symbol SMNDC1
Protein Name survival motor neuron domain containing 1
Synonyms SMNR|SPF30|TDRD16C
Ortholog resource in our bank

  SMNDC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007868 IRAK019L04 pCMV-SPORT6 BC011234 NM_005871

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR124408 ARh11A08 pGCAP1 NM_005871.3  
AAATGTGGAGTTCTTCCTTTTCAGACCGGGTCGCCTTGCTGTCGTCGCGGTGATTTTCCT
HKR385281 RBd63D09 pGCAP10 NM_005871.3  
GGTCTTTTCCTCCTTCCAGTGCCCGGCGTTCCTCCCTTCCCCCTCGCCGCCGACCGAGTT
HKR461639 RBdS154B15 pGCAP10 NM_005871.3  
TGGGTTCCTCCCTTCCCCCTCGCCGCCGACCGAGTTCTTCCTTTTCAGACCGGGTCGCCT
HKR461640 RBdS154B16 pGCAP10 NM_005871.3  
GCTCTCGCCAGGCGTCCTCGTGGAAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl