Prev. |  KEGG KO K12737 > 

RIKEN DNA Bank Human Resource - CWC27

Gene ID NCBI Gene 10283 |  KEGG hsa:10283
Gene Symbol CWC27
Protein Name CWC27 spliceosome associated cyclophilin
Synonyms NY-CO-10|RPSKA|SDCCAG-10|SDCCAG10
Ortholog resource in our bank

  CWC27

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091625 IRAL029B01 pOTB7 BC012117 NM_005869 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331745 RBb29G01 pGCAP1 NM_005869.2  
GGCGGTGCTCGGGTCCGGTAACAACATGGCGGCGTCCGTGAGGGGCTCCTTTGGGCAGGG
HKR344827 RBb62B03 pGCAP1 NM_005869.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl