Prev. |  KEGG KO K20719 > 

RIKEN DNA Bank Human Resource - SIGMAR1

Gene ID NCBI Gene 10280 |  KEGG hsa:10280
Gene Symbol SIGMAR1
Protein Name sigma non-opioid intracellular receptor 1
Synonyms ALS16|DSMA2|OPRS1|SIG-1R|SR-BP|SR-BP1|SRBP|hSigmaR1|sigma1R
Ortholog resource in our bank

  SIGMAR1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084703 IRAL011M15 pOTB7 BC004899 NM_005866 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004636 W01A011J20 pENTR-TOPO flj0055b12 AK130502 NM_005866  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042971 ARe07H03 pKA1U5 NM_005866.2  
GGGCGGTGGCGGGGGAGCGCTTCGATGGGCAGCCGGTTAGGCTCCGAGGCCGTGAGCGCA
HKR235152 ARiS087O16 pGCAP10 NM_005866.2  
GAGGCCCCGGCTCCCTCCTGAGCTGCGCCGTGCCAGGCCGCCCGCCGGGATGCAGTGGGC
HKR264417 ARiS161A17 pGCAP10 NM_005866.2  
TGAAAAGCCTCAGGCCCCGGCTCCCTCCTGAGCTGCGCCGTGCCAGGCCGCCCGCCGGGA
HKR333356 RBb33G12 pGCAP1 NM_005866.2  
GGGCGGGCTCCGAGGCCGTGAGCGCAAAGCCTCAGGCCCCGGCTCCCTCCTGAGCTGCGC
HKR334500 RBb36E04 pGCAP1 NM_005866.2  
AAATGTGTCCACGGCGGTGGCGGGGGAGCGCTTCGTGGGCAGCCGGCGGGCTCCGAGGCC
HKR344825 RBb62B01 pGCAP1 NM_005866.2  
HKR346830 RBb67B06 pGCAP1 NM_005866.2  
GGGGCAGCCGGCGGGCTCCGAGGCCGTGAGCGCAAAGCCTCAGGCCCCGGCTCCCTCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl