Prev. | 

RIKEN DNA Bank Human Resource - FSTL3

Gene ID NCBI Gene 10272 |  KEGG hsa:10272
Gene Symbol FSTL3
Protein Name follistatin like 3
Synonyms FLRG|FSRP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081032 IRAL002J16 pOTB7 BC005839 NM_005860 Full
HGY097353 IRAL043G09 pOTB7 BC033119 NM_005860 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062882 ARe57D10 pKA1U5 NM_005860.2  
GGGTGCCGCTGCCGTCTCTGCGATTCGCCATGCGCTCCCGGGGCGCCAGGGCCACTCTGG
HKR162980 ARi07H12 pGCAP10 NM_005860.2  
GGGTGCCGCTGCCGTCTCTGCGTTCGCCATGCGTCCCGGGGCGCCAGGGCCACTCTGGCC
HKR171772 ARi29H04 pGCAP10 NM_005860.2  
GGGGCCAGAAGCTGGGTGTCAGGAGTGGCCCAGGAGAGCACCCCGTTCCCCGGCCCGCAG
HKR179601 ARi49A01 pGCAP10 NM_005860.2  
GGTCGGTGCCGCTGCCGTCTCTGCGTTCGCCATGCGTCCCGGGGCGCCAGGGCCACTCTG
HKR235102 ARiS087M14 pGCAP10 NM_005860.2  
GAGGGAGCGCCGGCCGCGCGCTGGGAAGTCGGTGCCGCTGCCGTCTCTGCGTTCGCCATG
HKR430228 RBdS075J12 pGCAP10 NM_005860.2  
GAGAAGAGCGCGTGCATCGGGAGCAGACGTCAGCCAGCTGCAAGGAGGAGCGGCCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl