Prev. |  KEGG KO K12831 > 

RIKEN DNA Bank Human Resource - SF3B4

Gene ID NCBI Gene 10262 |  KEGG hsa:10262
Gene Symbol SF3B4
Protein Name splicing factor 3b subunit 4
Synonyms AFD1|Hsh49|SAP49|SF3b49
Ortholog resource in our bank

  SF3B4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085419 IRAL013J03 pOTB7 BC004273 NM_005850 Full
HGY085961 IRAL014P01 pOTB7 BC013886 NM_005850 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006913 W01A017E17 pENTR-TOPO IRAL013J03 BC004273 NM_005850  
HGE006919 W01A017E23 pENTR-TOPO IRAL013J03 BC004273 NM_005850  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR347635 RBb69B11 pGCAP1 NM_005850.3  
GGCTGCTGGGAGACGGCGGGATCTCTTTCGCCATGGCTGCCGGGCCGATCTCCGAGCGGA
HKR348978 RBb72H10 pGCAP1 NM_005850.3  
TGGAGACGGCGGGATCTCTTTCGCCATGGCTGCCGGGCCGATCTCCGAGCGGAATCAGGA
HKR395352 RBd88G08 pGCAP10 NM_005850.3  
GAGGCGGAACCGCTGCTGGGAGACGGCGGGATCTCTTTCGCCATGGCTGCCGGGCCGATC
HKR442016 RBdS105A16 pGCAP10 NM_005850.3  
GCTCTTTCGCCATGGCTGCCGGGCCGATCTCCGAGCGGAATCAGGATGCCACTGTGTACG
HKR471171 RBdS177P11 pGCAP10 NM_005850.3  
GGGCGGGATCTCTTTCGCCATGGCTGCCGGGCCGATCTCCGAGCGGAATCAGGATGCCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl